Review




Structured Review

Sangon Biotech shrna sequences targeting cherp
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Shrna Sequences Targeting Cherp, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/sequences+shrna/pmc13255054-307-1-8
Average 86 stars, based on 1 article reviews
shrna sequences targeting cherp - by Bioz Stars, 2026-09
86/100 stars

Images

1) Product Images from "Decoding neuron-specific lineage to identify diagnostic biomarkers and therapeutic targets for ischemic stroke"

Article Title: Decoding neuron-specific lineage to identify diagnostic biomarkers and therapeutic targets for ischemic stroke

Journal: iScience

doi: 10.1016/j.isci.2026.116257

Cherp serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using shRNA. (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Figure Legend Snippet: Cherp serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using shRNA. (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.

Techniques Used: Expressing, Biomarker Discovery, shRNA, Viability Assay, TUNEL Assay, Staining, Functional Assay, Imaging, Fluorescence

Related Articles

Sequencing:

Article Title: Protein inhibitor of activated STAT xα depresses cyclin D and cyclin D kinase, and contributes to the inhibition of osteosarcoma cell progression.
Article Snippet: Small interfer ing (si)RNAs of PIAsxα and the GAPDH control were constructed using a Silencer siRNA Construction kit (Ambion; Thermo Fisher Scientific, Inc.), according to a previous report (21). .. The siRNA sequence was 5'‐GUGGAAGGCAACGAGUGGAUU‐3, which was synthesize by Shanghai Sangon Biotech Co., Ltd. ..

Article Title: Super-enhancer-associated lncRNA HDAC11-AS1 aggravates hepatocellular carcinoma progression by modulating HDAC11 and NUP210 expression via promoting super-enhancer activity.
Article Snippet: .. The siRNA sequence and CRISPR-on sgRNAs sequence were listed in supplementary table 1 and obtained from Sangon Biotech (Shanghai, China). .. The siRNA and plasmids were introduced into HCC cells through Lipofectamine 3000-mediated transfection (Thermo Fisher Scientific, CA, USA), following the manufacturer's recommended protocols.

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: .. For lncRNA and gene knockdown, siRNA sequence was designed and purchased from Sangon Biotech and then cloned into pSiCoR shRNA vector. .. For lentivirus production, 293T cells were transfected with pSiCoR, VSVG, pMDL gp RRE and RSV-REV vectors for 3 days.

Article Title: AiTFAM modulates growth and thermotolerance of scallop Argopecten irradians irradians via regulating mitochondrial dynamics
Article Snippet: Mitochondrial transcription factor A (TFAM) is a core regulator of mitochondrial DNA (mtDNA) replication and transcription, playing a vital role in cellular energy metabolism and physiological traits regulation.. However, its function in marine bivalves remains poorly understood.. In this study, a TFAM ortholog (AiTFAM) was identified in the bay scallop Argopecten irradians irradians via genome-wide homology-based screening.

CRISPR:

Article Title: Super-enhancer-associated lncRNA HDAC11-AS1 aggravates hepatocellular carcinoma progression by modulating HDAC11 and NUP210 expression via promoting super-enhancer activity.
Article Snippet: .. The siRNA sequence and CRISPR-on sgRNAs sequence were listed in supplementary table 1 and obtained from Sangon Biotech (Shanghai, China). .. The siRNA and plasmids were introduced into HCC cells through Lipofectamine 3000-mediated transfection (Thermo Fisher Scientific, CA, USA), following the manufacturer's recommended protocols.

Knockdown:

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: .. For lncRNA and gene knockdown, siRNA sequence was designed and purchased from Sangon Biotech and then cloned into pSiCoR shRNA vector. .. For lentivirus production, 293T cells were transfected with pSiCoR, VSVG, pMDL gp RRE and RSV-REV vectors for 3 days.

Clone Assay:

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: .. For lncRNA and gene knockdown, siRNA sequence was designed and purchased from Sangon Biotech and then cloned into pSiCoR shRNA vector. .. For lentivirus production, 293T cells were transfected with pSiCoR, VSVG, pMDL gp RRE and RSV-REV vectors for 3 days.

shRNA:

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: .. For lncRNA and gene knockdown, siRNA sequence was designed and purchased from Sangon Biotech and then cloned into pSiCoR shRNA vector. .. For lentivirus production, 293T cells were transfected with pSiCoR, VSVG, pMDL gp RRE and RSV-REV vectors for 3 days.

Plasmid Preparation:

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: .. For lncRNA and gene knockdown, siRNA sequence was designed and purchased from Sangon Biotech and then cloned into pSiCoR shRNA vector. .. For lentivirus production, 293T cells were transfected with pSiCoR, VSVG, pMDL gp RRE and RSV-REV vectors for 3 days.

Synthesized:

Article Title: AiTFAM modulates growth and thermotolerance of scallop Argopecten irradians irradians via regulating mitochondrial dynamics
Article Snippet: Mitochondrial transcription factor A (TFAM) is a core regulator of mitochondrial DNA (mtDNA) replication and transcription, playing a vital role in cellular energy metabolism and physiological traits regulation.. However, its function in marine bivalves remains poorly understood.. In this study, a TFAM ortholog (AiTFAM) was identified in the bay scallop Argopecten irradians irradians via genome-wide homology-based screening.



Similar Products

86
Sangon Biotech shrna sequences targeting cherp
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Shrna Sequences Targeting Cherp, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/sequences+shrna/pmc13255054-307-1-8
Average 86 stars, based on 1 article reviews
shrna sequences targeting cherp - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Obio Technology Corp Ltd sirna sequences
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Sirna Sequences, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/sirna/pm42321503-66-1-7
Average 86 stars, based on 1 article reviews
sirna sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Genechem shrna sequences
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Shrna Sequences, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/sequences+shrna/pm42270806-48-9-5
Average 86 stars, based on 1 article reviews
shrna sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech fasn targeting shrna sequences
<t>Cherp</t> serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using <t>shRNA.</t> (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.
Fasn Targeting Shrna Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/sequences+shrna/pm42237939-105-0-6
Average 86 stars, based on 1 article reviews
fasn targeting shrna sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Shanghai Genechem Ltd mzb1 sirna sequences
<t>MZB1</t> is significantly upregulated in gingival tissues of periodontitis patients. (A) Histogram of the number of transcriptomics differential genes in gingival tissues of patients with periodontitis. (B) Volcano plot of differentially expressed genes, highlighting MZB1 as the gene with the most significant upregulation. (C) GO biological process and KEGG pathway enrichment analysis of differentially expressed genes; upper right quadrant shows enrichment of upregulated genes, while lower left indicates downregulated genes. (D) Quantitative RT-PCR analysis of MZB1 mRNA expression in gingival tissues from periodontitis patients and healthy controls (N = 20).
Mzb1 Sirna Sequences, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/mzb1+sequences+sirna/pmc12966909-54-2-15
Average 86 stars, based on 1 article reviews
mzb1 sirna sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech small interfering rna sequences targeting tgf β1
The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of <t>TGF-β1,</t> phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.
Small Interfering Rna Sequences Targeting Tgf β1, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/sequences+sirna/pmc13196827-126-1-24
Average 86 stars, based on 1 article reviews
small interfering rna sequences targeting tgf β1 - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

94
OriGene human tmprss2 targeting shrna sequences
The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of <t>TGF-β1,</t> phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.
Human Tmprss2 Targeting Shrna Sequences, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/TMPRSS2+Human+shRNA+Plasmid+Kit/pm42156913-285-22-28
Average 94 stars, based on 1 article reviews
human tmprss2 targeting shrna sequences - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

86
Sangon Biotech sirna sequence
The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of <t>TGF-β1,</t> phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.
Sirna Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/sequences+sirna/pm42126774-40-1-16
Average 86 stars, based on 1 article reviews
sirna sequence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Shanghai Generay Biotech ho 1 sirna sequences
The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of <t>TGF-β1,</t> phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.
Ho 1 Sirna Sequences, supplied by Shanghai Generay Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sirna+sequence/1+ho+sequences+sirna/pm42114659-99-1-7
Average 86 stars, based on 1 article reviews
ho 1 sirna sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results


Cherp serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using shRNA. (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.

Journal: iScience

Article Title: Decoding neuron-specific lineage to identify diagnostic biomarkers and therapeutic targets for ischemic stroke

doi: 10.1016/j.isci.2026.116257

Figure Lengend Snippet: Cherp serving an effective treatment target for IS (A) The neuron counts of cluster 3 and 5. (B) The Cherp expression in each cluster. (C) The WB image of Cherp expression after OGD/R process. (D) The IF images of Cherp expression after OGD/R process. Scale bars = 100 μm. (E) The efficiency validation of Cherp knocking down using shRNA. (F) The cell viability assay after Cherp knocking down. (G) LDH leakage assay after Cherp knocking down. (H) TUNEL assay after Cherp knocking down. Scale bars = 100 μm. (I) WB image of apoptosis-related markers after Cherp knocking down. (J) Morphology of cerebral edema in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery. (K) TTC staining of cerebral infarction in sham, MCAO and MCAO-shRNA intervention groups at 72 h post-surgery (Dashed area represents the infarcted brain region). (L) Statistics analysis of brain water content ( n = 5 mice/group). (M) Quantification of infarct area ( n = 5 mice/group). (N) The functional enrichment of Cherp high cells related pathways. (O) The intracellular calcium imaging after Cherp knocking down. Scale bars = 100 μm (P) Quantitative analysis of intracellular Ca 2+ fluorescence intensity in primary neurons under indicated conditions ( n = 3 independent experiments). Data are presented as mean ± SD. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001 and ∗∗∗∗ p < 0.0001 as determined by Student’s t test.

Article Snippet: The shRNA sequences targeting Cherp were generated at Sangon Biotech.

Techniques: Expressing, Biomarker Discovery, shRNA, Viability Assay, TUNEL Assay, Staining, Functional Assay, Imaging, Fluorescence

MZB1 is significantly upregulated in gingival tissues of periodontitis patients. (A) Histogram of the number of transcriptomics differential genes in gingival tissues of patients with periodontitis. (B) Volcano plot of differentially expressed genes, highlighting MZB1 as the gene with the most significant upregulation. (C) GO biological process and KEGG pathway enrichment analysis of differentially expressed genes; upper right quadrant shows enrichment of upregulated genes, while lower left indicates downregulated genes. (D) Quantitative RT-PCR analysis of MZB1 mRNA expression in gingival tissues from periodontitis patients and healthy controls (N = 20).

Journal: International Dental Journal

Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation

doi: 10.1016/j.identj.2026.109452

Figure Lengend Snippet: MZB1 is significantly upregulated in gingival tissues of periodontitis patients. (A) Histogram of the number of transcriptomics differential genes in gingival tissues of patients with periodontitis. (B) Volcano plot of differentially expressed genes, highlighting MZB1 as the gene with the most significant upregulation. (C) GO biological process and KEGG pathway enrichment analysis of differentially expressed genes; upper right quadrant shows enrichment of upregulated genes, while lower left indicates downregulated genes. (D) Quantitative RT-PCR analysis of MZB1 mRNA expression in gingival tissues from periodontitis patients and healthy controls (N = 20).

Article Snippet: The specific MZB1 siRNA sequences were as follows: shRNA-1: 5’-GATGAAGAGAAGTACGCATCC-3’; shRNA-2: 5’-GCGAAGAGCAGAGGCTAA TCT-3’; shRNA-3: 5’-GCAGTCCTATGGAGTCCAAGA-3’ (Shanghai Genechem Co., Ltd., China).

Techniques: Transcriptomics, Quantitative RT-PCR, Expressing

Lentiviral knockdown of MZB1 attenuates LPS-induced cytotoxicity and enhances PDLSC migration and viability. (A) Knockdown efficiency of MZB1 in PDLSCs transduced with lentivirus-mediated shRNA. (B) Western blot analysis of MZB1 protein expression. (C) Quantification of MZB1 protein levels normalised to β-Actin based on grayscale intensity (N = 3). (D) Cell viability of PDLSCs following lentiviral transduction and LPS stimulation, as measured by CCK-8 assay (N = 5). (E) Quantification of wound closure rates in the scratch assay (N = 3). (F) Quantitative analysis of cell viability by absorbance at 570 nm following crystal violet staining. (G) Representative images of wound healing assay at 24 hours post-injury. (H) Representative microscopic images of PDLSCs stained with crystal violet (comparisons in panel B are relative to Control shRNA).

Journal: International Dental Journal

Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation

doi: 10.1016/j.identj.2026.109452

Figure Lengend Snippet: Lentiviral knockdown of MZB1 attenuates LPS-induced cytotoxicity and enhances PDLSC migration and viability. (A) Knockdown efficiency of MZB1 in PDLSCs transduced with lentivirus-mediated shRNA. (B) Western blot analysis of MZB1 protein expression. (C) Quantification of MZB1 protein levels normalised to β-Actin based on grayscale intensity (N = 3). (D) Cell viability of PDLSCs following lentiviral transduction and LPS stimulation, as measured by CCK-8 assay (N = 5). (E) Quantification of wound closure rates in the scratch assay (N = 3). (F) Quantitative analysis of cell viability by absorbance at 570 nm following crystal violet staining. (G) Representative images of wound healing assay at 24 hours post-injury. (H) Representative microscopic images of PDLSCs stained with crystal violet (comparisons in panel B are relative to Control shRNA).

Article Snippet: The specific MZB1 siRNA sequences were as follows: shRNA-1: 5’-GATGAAGAGAAGTACGCATCC-3’; shRNA-2: 5’-GCGAAGAGCAGAGGCTAA TCT-3’; shRNA-3: 5’-GCAGTCCTATGGAGTCCAAGA-3’ (Shanghai Genechem Co., Ltd., China).

Techniques: Knockdown, Migration, Transduction, shRNA, Western Blot, Expressing, CCK-8 Assay, Wound Healing Assay, Staining, Control

Knockdown of MZB1 alleviates LPS-induced ER stress and apoptosis in PDLSCs. (A) Western blot chemiluminescence imaging of endoplasmic reticulum stress-related proteins, including p-PERK, ATF4, CHOP, and GPR78, in PDLSCs cells under LPS treatment. (B) Quantitative analysis of protein band intensities for p-PERK, ATF4, CHOP, and GRP78, normalised to β-Actin (N=3). (C) Flow cytometric analysis of apoptosis using Annexin V-PE and 7-AAD staining. (D) Quantification of apoptosis rates based on flow cytometry results (N = 3). (E) Western blot chemiluminescence imaging of apoptosis-related proteins BCL-2 and BAX in PDLSCs cells under LPS treatment. (F) Quantitative analysis of BCL-2 and BAX protein expression normalised to β-Actin (N=3).

Journal: International Dental Journal

Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation

doi: 10.1016/j.identj.2026.109452

Figure Lengend Snippet: Knockdown of MZB1 alleviates LPS-induced ER stress and apoptosis in PDLSCs. (A) Western blot chemiluminescence imaging of endoplasmic reticulum stress-related proteins, including p-PERK, ATF4, CHOP, and GPR78, in PDLSCs cells under LPS treatment. (B) Quantitative analysis of protein band intensities for p-PERK, ATF4, CHOP, and GRP78, normalised to β-Actin (N=3). (C) Flow cytometric analysis of apoptosis using Annexin V-PE and 7-AAD staining. (D) Quantification of apoptosis rates based on flow cytometry results (N = 3). (E) Western blot chemiluminescence imaging of apoptosis-related proteins BCL-2 and BAX in PDLSCs cells under LPS treatment. (F) Quantitative analysis of BCL-2 and BAX protein expression normalised to β-Actin (N=3).

Article Snippet: The specific MZB1 siRNA sequences were as follows: shRNA-1: 5’-GATGAAGAGAAGTACGCATCC-3’; shRNA-2: 5’-GCGAAGAGCAGAGGCTAA TCT-3’; shRNA-3: 5’-GCAGTCCTATGGAGTCCAAGA-3’ (Shanghai Genechem Co., Ltd., China).

Techniques: Knockdown, Western Blot, Imaging, Staining, Flow Cytometry, Expressing

Knockdown of MZB1 restores osteogenic differentiation capacity of PDLSCs under inflammatory conditions (A) Microscopic images of alizarin red S staining showing calcium nodule formation after osteogenic induction of PDLSCs under different conditions. (B) Quantification of alizarin red S staining by absorbance at 560 nm (N = 3). (C) Quantitative analysis of alkaline phosphatase (ALP) activity following osteogenic induction of PDLSCs (N = 3). (D) Western blot images of osteogenic differentiation-related proteins (RUNX2, BMP2, α-SMA, and Collagen I) in PDLSCs. (E) Quantification of Western blot bands normalised to β-Actin, representing relative expression levels of osteogenic markers (N = 3).

Journal: International Dental Journal

Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation

doi: 10.1016/j.identj.2026.109452

Figure Lengend Snippet: Knockdown of MZB1 restores osteogenic differentiation capacity of PDLSCs under inflammatory conditions (A) Microscopic images of alizarin red S staining showing calcium nodule formation after osteogenic induction of PDLSCs under different conditions. (B) Quantification of alizarin red S staining by absorbance at 560 nm (N = 3). (C) Quantitative analysis of alkaline phosphatase (ALP) activity following osteogenic induction of PDLSCs (N = 3). (D) Western blot images of osteogenic differentiation-related proteins (RUNX2, BMP2, α-SMA, and Collagen I) in PDLSCs. (E) Quantification of Western blot bands normalised to β-Actin, representing relative expression levels of osteogenic markers (N = 3).

Article Snippet: The specific MZB1 siRNA sequences were as follows: shRNA-1: 5’-GATGAAGAGAAGTACGCATCC-3’; shRNA-2: 5’-GCGAAGAGCAGAGGCTAA TCT-3’; shRNA-3: 5’-GCAGTCCTATGGAGTCCAAGA-3’ (Shanghai Genechem Co., Ltd., China).

Techniques: Knockdown, Staining, Activity Assay, Western Blot, Expressing

AAV-mediated knockdown of MZB1 alleviates periodontal inflammation and tissue damage in a rat model of periodontitis. (A) Western blot analysis of MZB1 protein expression in rat periodontal tissues. (B) Quantitative densitometry of MZB1 protein expression normalised to β-Actin (N = 3). (C) Body weight changes in rats after AAV-mediated knockdown of MZB1 in the periodontitis model (N = 6). (D) Representative H&E-stained images of rat periodontal tissue sections. (E) Quantitative analysis of histopathological parameters, including inflammatory cell infiltration, alveolar bone resorption, and loss of periodontal attachment (N = 6). (F) ELISA-based quantification of inflammatory cytokines TNF-α, IL-6, IL-17A, and anti-inflammatory factor TGF-β1 in rat periodontal tissues (N = 6).

Journal: International Dental Journal

Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation

doi: 10.1016/j.identj.2026.109452

Figure Lengend Snippet: AAV-mediated knockdown of MZB1 alleviates periodontal inflammation and tissue damage in a rat model of periodontitis. (A) Western blot analysis of MZB1 protein expression in rat periodontal tissues. (B) Quantitative densitometry of MZB1 protein expression normalised to β-Actin (N = 3). (C) Body weight changes in rats after AAV-mediated knockdown of MZB1 in the periodontitis model (N = 6). (D) Representative H&E-stained images of rat periodontal tissue sections. (E) Quantitative analysis of histopathological parameters, including inflammatory cell infiltration, alveolar bone resorption, and loss of periodontal attachment (N = 6). (F) ELISA-based quantification of inflammatory cytokines TNF-α, IL-6, IL-17A, and anti-inflammatory factor TGF-β1 in rat periodontal tissues (N = 6).

Article Snippet: The specific MZB1 siRNA sequences were as follows: shRNA-1: 5’-GATGAAGAGAAGTACGCATCC-3’; shRNA-2: 5’-GCGAAGAGCAGAGGCTAA TCT-3’; shRNA-3: 5’-GCAGTCCTATGGAGTCCAAGA-3’ (Shanghai Genechem Co., Ltd., China).

Techniques: Knockdown, Western Blot, Expressing, Staining, Enzyme-linked Immunosorbent Assay

Knockdown of MZB1 reduces apoptosis in periodontal tissues of rats with periodontitis. (A) Representative TUNEL-stained images (80 ×) of rat periodontal tissue sections. Apoptotic cells are labeled with green fluorescence, and nuclei are counterstained with DAPI (blue). (B) Quantitative analysis of apoptotic cell ratio in TUNEL-stained sections (N = 5). (C) Western blot analysis of apoptosis-related proteins (BAX and BCL-2) in rat periodontal tissues. (D) Quantification of BAX and BCL-2 protein expression normalised to β-Actin (N = 3). (* P < .05, ** P < .01, *** P < .001, **** P < .0001).

Journal: International Dental Journal

Article Title: MZB1 Drives Periodontitis via ER Stress-Mediated Inflammation and Osteogenic Differentiation

doi: 10.1016/j.identj.2026.109452

Figure Lengend Snippet: Knockdown of MZB1 reduces apoptosis in periodontal tissues of rats with periodontitis. (A) Representative TUNEL-stained images (80 ×) of rat periodontal tissue sections. Apoptotic cells are labeled with green fluorescence, and nuclei are counterstained with DAPI (blue). (B) Quantitative analysis of apoptotic cell ratio in TUNEL-stained sections (N = 5). (C) Western blot analysis of apoptosis-related proteins (BAX and BCL-2) in rat periodontal tissues. (D) Quantification of BAX and BCL-2 protein expression normalised to β-Actin (N = 3). (* P < .05, ** P < .01, *** P < .001, **** P < .0001).

Article Snippet: The specific MZB1 siRNA sequences were as follows: shRNA-1: 5’-GATGAAGAGAAGTACGCATCC-3’; shRNA-2: 5’-GCGAAGAGCAGAGGCTAA TCT-3’; shRNA-3: 5’-GCAGTCCTATGGAGTCCAAGA-3’ (Shanghai Genechem Co., Ltd., China).

Techniques: Knockdown, TUNEL Assay, Staining, Labeling, Fluorescence, Western Blot, Expressing

The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of TGF-β1, phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of TGF-β1, phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Expressing, Membrane, Western Blot, Immunohistochemistry, Control

Characterization of endothelial progenitor cells (EPCs) and transfection efficacy of small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1). a) was the immunofluorescence result of cluster of differentiation (CD)34 and vascular endothelial growth factor receptor 2 (VEGFR2). b) EPCs could simultaneously absorb DiI-labelled acetylated low-density lipoprotein (Dil-Ac-LDL) and fluorescein isothiocyanate-labeled Ulex europaeus agglutinin I (FITC-UEA-I). Scale bar: 100 μm. c) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. d) Western blot was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the si-TGF-β1 negative control (NC) group; ##p < 0.01, ###p < 0.001 vs the si-TGF-β1 #2 group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: Characterization of endothelial progenitor cells (EPCs) and transfection efficacy of small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1). a) was the immunofluorescence result of cluster of differentiation (CD)34 and vascular endothelial growth factor receptor 2 (VEGFR2). b) EPCs could simultaneously absorb DiI-labelled acetylated low-density lipoprotein (Dil-Ac-LDL) and fluorescein isothiocyanate-labeled Ulex europaeus agglutinin I (FITC-UEA-I). Scale bar: 100 μm. c) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. d) Western blot was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the si-TGF-β1 negative control (NC) group; ##p < 0.01, ###p < 0.001 vs the si-TGF-β1 #2 group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Transfection, Small Interfering RNA, Immunofluorescence, Labeling, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Negative Control

The effect of naringin on the proliferation and viability of endothelial progenitor cells (EPCs). a) 5-ethynyl-2'-deoxyuridine (EdU) staining method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). Scale bar: 100 μm. N = 5/group. b) Cell Counting Kit-8 (CCK-8, Beyotime, China) method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, ** p< 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the proliferation and viability of endothelial progenitor cells (EPCs). a) 5-ethynyl-2'-deoxyuridine (EdU) staining method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). Scale bar: 100 μm. N = 5/group. b) Cell Counting Kit-8 (CCK-8, Beyotime, China) method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, ** p< 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Staining, Cell Counting, CCK-8 Assay, Control, Small Interfering RNA

The effect of naringin on the migration, invasion and tube formation of endothelial progenitor cells (EPCs). a) Scratch wound was used to detect the invasion area of EPCs within 24 hours. Scale bar: 200 μm. b) Transwell assay was used to detect the number of migrated EPCs at 24 hours. Scale bar: 100 μm. c) The tube formation experiment detected the total tube length of EPCs. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). **p < 0.01, ***p < 0.001 vs the control group; ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the migration, invasion and tube formation of endothelial progenitor cells (EPCs). a) Scratch wound was used to detect the invasion area of EPCs within 24 hours. Scale bar: 200 μm. b) Transwell assay was used to detect the number of migrated EPCs at 24 hours. Scale bar: 100 μm. c) The tube formation experiment detected the total tube length of EPCs. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). **p < 0.01, ***p < 0.001 vs the control group; ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Migration, Transwell Assay, Control, Small Interfering RNA

The effect of naringin on angiogenic-osteogenic and transforming growth factor β (TGF-β)/SMAD pathway-related factors of endothelial progenitor cells (EPCs). a) The concentrations of platelet derived growth factor BB (PDGF-BB), vascular endothelial growth factor (VEGF), and slit guidance ligand 3 (SLIT3) in the supernatant of EPCs were detected by enzyme-linked immunosorbent assay. b) Alizarin red staining (ARS) was performed to detect mineralized nodules in osteoblasts. Scale bar: 50 μm. c) The protein level of p-SMAD2 and p-SMAD3 in EPCs was detected by western blot. d) was the immunofluorescence result of p-SMAD2. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the control group; ##p < 0.01, ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on angiogenic-osteogenic and transforming growth factor β (TGF-β)/SMAD pathway-related factors of endothelial progenitor cells (EPCs). a) The concentrations of platelet derived growth factor BB (PDGF-BB), vascular endothelial growth factor (VEGF), and slit guidance ligand 3 (SLIT3) in the supernatant of EPCs were detected by enzyme-linked immunosorbent assay. b) Alizarin red staining (ARS) was performed to detect mineralized nodules in osteoblasts. Scale bar: 50 μm. c) The protein level of p-SMAD2 and p-SMAD3 in EPCs was detected by western blot. d) was the immunofluorescence result of p-SMAD2. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the control group; ##p < 0.01, ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Derivative Assay, Enzyme-linked Immunosorbent Assay, Staining, Western Blot, Immunofluorescence, Control, Small Interfering RNA

Interactions between naringin and transforming growth factor-β1 (TGF-β1). a) The basic chemical structure of naringin. b) 3D and 2D molecular docking patterns of naringin with TGF-β1. c) to g) Results of molecular dynamics simulation analysis illustrating root mean square deviation (RMSD), root mean square fluctuation (RMSF), radius of gyration (Rg), solvent-accessible surface area (SASA), and hydrogen-bond number for the TGF-β1-naringin complexes. h) Representative images of cellular thermal shift assay (CETSA) showing TGF-β1 thermal stability after naringin treatment. i) CETSA curve was performed using GraphPad Prism (GraphPad Software, USA). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the dimethyl sulfoxide (DMSO) group.

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: Interactions between naringin and transforming growth factor-β1 (TGF-β1). a) The basic chemical structure of naringin. b) 3D and 2D molecular docking patterns of naringin with TGF-β1. c) to g) Results of molecular dynamics simulation analysis illustrating root mean square deviation (RMSD), root mean square fluctuation (RMSF), radius of gyration (Rg), solvent-accessible surface area (SASA), and hydrogen-bond number for the TGF-β1-naringin complexes. h) Representative images of cellular thermal shift assay (CETSA) showing TGF-β1 thermal stability after naringin treatment. i) CETSA curve was performed using GraphPad Prism (GraphPad Software, USA). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the dimethyl sulfoxide (DMSO) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Solvent, Thermal Shift Assay, Software